Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DA0207
Clone ID DA0207
Vector pGT1lxr
Project sanger

Sequence tag DA0207
Sequence
GGGAGCAGGACGAGAAGACTAGTGCAGTGAAGGAGGAGCTCAAATACTGGCAGAAACTTTGCCATGACCTGGAGCGAGCG
CGGCTGCTGATCGAGCTCATCCGCAAAAGGGAGAAGCTCAAGCTGGAGCAGGTCAAAGTACAGCGGGCTGCCATGGACCC
GGACCAGAGGCCGTGAAGGGTCCTTTTTTTTTTTTTTTTGTCGTTTACTACCCTTTCATCATGAAGTATAATGCTAAAGA
CACAATTTTCCACCGAGCAGCTGTCCGCCTCCGGGACCTGGGAGGGGCCATCATGCGGCACGCCCGGCGGCAGGCAGAGA
ACATCGGCTATGATCCTGAGAGGGGCACCCACTTGCCCGAATCACCCAGATTGGAAGACTTTTACCGATTCTCCTGGGAG
GATG
Sequence Type mRNA
Unitrap ID UNI3136

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 28951532..28954743 183
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063952 (Brpf3) NM_001081315 bromodomain and PHD finger containing, 3 Gene [Source:MGI (curated);Acc:Brpf3-001]

 
Come back to gene ENSMUSG00000063952


For any suggestions or comments, please send an email to unitrap@crg.es