Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10439H1
Clone ID IST10439H1
Vector VICTR76
Project tigm

Sequence tag IST10439H1BBF1
Sequence
GTTTTCTTTCTAACATTTCCCAAGATTACATGACAGCTCATGGGGCTTCCTTCAGTACAGTANAAGGCTGCTTCTGCTTC
CCTTGGTGAGATCCTTCAATACCACCTTTCAGATTCTAGTCAAGGANGAGCCTACCCTGATTACTCAACTCTGCCCTTGA
AATAAGTTCCCAGCATCCACAAGCGGCCAAACAACTCCAGTTCTGGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180437579..180437789 207
NO GENE  


Sequence tag IST10439H1HMR1
Sequence
ACTACTCAAGACCTGGGCTTNNGAATGGAGCATTGGAGGCCTCTACAATGTGAGAGAGGCCTTACTAGACCGGANCACAT
GTTTGTTACAGGAAGCCGAAGTTAGAGTCCAGAAGAATGGCTTCCTAGCGTTGTGTCTGTGTGCTTACATAAATAAGAAG
CTGGTTGTATGGGGCAAAGCTGAGCGTCTATCCCGGCATTAACTGCCCTCAGAGCAATGTGGCTAGTGTTCACGTTGCGA
CCTCTTTCTGGTTTCCTTAAGTAATATGGGGGACAGTGAAGGAATATCACTGTANTTANCGCTAGGGGGGGAAATTCNTA
AATGCCTTCGTGAGGGGACTGGGGGTGGGGCCCNNGNAGGCNCNNNTGCN
Sequence Type genomic DNA
Unitrap ID UNI6398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180437220..180437580 343
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]


Sequence tag IST10439H1HMF1
Sequence
ANNNCNNTCTCCANTNCNAGTCTAANCCNCAGAGCACTCTGGAGGACNCANGGTGCTCANTTGCCANNTGCGAACCNANT
TGAACTATNNANATCTACCNNCNTGACTGAATTNNNNNTGAAATGACNGTGCCTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000038914


For any suggestions or comments, please send an email to unitrap@crg.es