Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14846H10
Clone ID IST14846H10
Vector VICTR76
Project tigm

Sequence tag IST14846H10HMF2
Sequence
CTTGTTATAGTTAAGTTTCCCCCGCCTTGTGATCAAGATTGGCCTTAAATTCACTCGCCACATAGTCTAGTTGTTTCAAA
TGGAAGTCTACCTGCGCGGTTTTTACTAGGTATATGCCAATCCTCTTGCTTTTTACTCTTAGGTTGTTTGTCACATGCCT
TTGTACTAGCCTTTCTCTACTCCCATTTTCTTTCTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 59597726..59597922 197
NO GENE  


Sequence tag IST14846H10HMR1
Sequence
NNCAANTGCAAGAAATAATCNNATGCANGTGCAAAGGCTGTTTTTGAAGATGGCTGATTGCCTGGGATGGCTGGCCTGTT
AGCTCCTGAAAGAATAAGGCAGCTANATCTCCAAGTGGGAAGCCAGTCTGAGCCAATTTTAAAAAAAAAAAAAAAAAAAA
AAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI11930

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 59597566..59597729 154
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051705 (Senp8) NM_027838 SUMO/sentrin specific peptidase 8 Gene [Source:MGI Symbol;Acc:MGI:1918849]

 
Come back to gene ENSMUSG00000051705


For any suggestions or comments, please send an email to unitrap@crg.es