Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10062D3
Clone ID IST10062D3
Vector VICTR75
Project tigm

Sequence tag IST10062D3HMR1
Sequence
AAAGGATGCAGAACAATCTCACAGGACGCTCACAGAAAAAGGTGTACC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 19875003..19875049 47
NO GENE  


Sequence tag IST10062D3BBF1
Sequence
CAGCAACCACATGGTGGCTCACAACCATCCGTAACAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI12672 UNI30731

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 26417983..26418026 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20308862..20308905 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 34849562..34849605 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 55580674..55580717 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 6042430..6042473 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068270 (Shroom4) NM_001040459 shroom family member 4 Gene [Source:MGI (curated);Acc:Shroom4-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 18030976..18031019 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026743 (Mllt10) NM_010804 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 Gene [Source:MGI (curated);Acc:Mllt10-001]

 
Come back to gene ENSMUSG00000026743


For any suggestions or comments, please send an email to unitrap@crg.es