Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14649H5
Clone ID IST14649H5
Vector VICTR74
Project tigm

Sequence tag IST14649H5HMR1
Sequence
CNGNACACTTNATTACTGGGTGGGGGAAGGATCATGTGTCNNTAACAAAATCTCTCCCAAGCTGGATTGAGGACAGAAAA
CCTCTTTGCCTGATACTTTTGGAAGGCTCCTGTTGGCTCCCAGGAGAGAGATCCTGGTCTTGACCTAGGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 74828528..74828673 140
 
EST/CDNA Est Name
  CN696886.1


Sequence tag IST14649H5HMF2
Sequence
CTGTGTGCTAACAATATAGCTTAAAAAAAAAAAANNNAAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14649H5BBF1
Sequence
CTGTGTGCTAACAATATAGCTTAAAAAAAAAAAAATTAAAAN
Sequence Type genomic DNA
Unitrap ID UNI32250

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 8288959..8288999 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052551 (Adarb2) NP_443209 adenosine deaminase, RNA-specific, B2 Gene [Source:MGI Symbol;Acc:MGI:2151118]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 22125416..22125456 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 74828675..74828715 39
NO GENE  

 
Come back to gene ENSMUSG00000052551


For any suggestions or comments, please send an email to unitrap@crg.es