Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13059B10
Clone ID IST13059B10
Vector VICTR76
Project tigm

Sequence tag IST13059B10HMF1
Sequence
GTTTCTCTGTGTAAACTTGGCTGTCCTGGAACTCACTGTGTAGACCAGGCTGGCCTT
Sequence Type genomic DNA
Unitrap ID UNI31645 UNI34817

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 24486062..24486118 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035435 (Abca17) NM_001031621 ATP-binding cassette, sub-family A (ABC1), member 17 Gene [Source:MGI (curated);Acc:Abca17-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 114517040..114517096 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 104740966..104741022 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 40570971..40571027 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 22910913..22910969 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 152667053..152667109 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066842 (Hmcn1) NP_001019891 hemicentin 1 Gene [Source:MGI (curated);Acc:Hmcn1-001]

 
Come back to gene ENSMUSG00000066842


For any suggestions or comments, please send an email to unitrap@crg.es