Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XR0234
Clone ID XR0234
Vector pGT0lxf
Project sanger

Sequence tag XR0234
Sequence
GAGGCCGGGCGGCTCAGGCGGCTGAGGTGGCCGCTGGCGCTCTGGTGGCGGGCGCGGCCGATATGGCGAAAAGCAGCAGA
GAGAATGGGNCCGCGCGAGCCCGCAGCAGGCGGGAGCCTGTCTGGGACCCGGGAAAGCCTGGCCCAGGGCCCCGACGCCG
CCACCGCCGACGAGCTGAGCTCGCTCGGCTCCGACTCGGAGGCCAACGGCTTCGCCGAGCGCCGCATCGACAAGTTCGGA
TTCATCGTGGGTTCGCAGGGCGCCGAGGGCGCACTGGAGGAAGTTCCCCTGGAGGTGCTGAGGCAGAGGGAGTCCAAGTG
GCTGGACATGCTCAACAACTGGGACAAATGGATGGCCAAGAAGCACAAAAAGATTCGTCTTCGATGCCAGAAGGGCATCC
CACCTTCTCTGCGCGGACGGGCTTGGCAGTACCTGTCGGGAGGCAAGGTGAAACTTCAGCAGAACCCTGGGAAGTTTGAT
Sequence Type mRNA
Unitrap ID UNI3139

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4086832..4110036 268
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034412 (Tbc1d10a) NP_598784 TBC1 domain family, member 10a Gene [Source:MGI (curated);Acc:Tbc1d10a-001]

 
Come back to gene ENSMUSG00000034412


For any suggestions or comments, please send an email to unitrap@crg.es