Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13606D12
Clone ID IST13606D12
Vector VICTR74
Project tigm

Sequence tag IST13606D12HMR1
Sequence
NANCCNTCTCACCANCCCTTGACAGGACTTTCTTATGGTGTGGACACACTAACATTGGGCGAGCAAGATAACCTTAATAA
ATTGCATATTANAAAATCCTTTTATTGTACATTTAACACATTAATATGACTTGACTGACACAATGCANATATTTTTGTTT
AAAATGGATTCTCTTTCCCAACTTAATTTTCTGTTTGTTTTTGAGACAGGGTCTCAACTATGTAACTCTGGCTGGCCTGG
GACTTACTATGTAAACTANGCTGGCCTGNANCTCANANATCCACTTGACTGTGCCTTCCANGTGCTGGGATTAAAGGCAT
GCNCCATCACTCACAACTANGTTTTTTGCCCCCTAACCCCCNATTTTTTTTTCTTGAAAGTCCNTTTNNNGAAANNNNNT
TANNTNAAAGGAAAATTNNTGTTTCANTTGGANGAGCCAANANTTGTNNNGGTNNTTTTGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13606D12BBF1
Sequence
GCTCAGTGGGTAAGAGCACCCGACTGCTCTTCCGAAGGTCCAGAGTTCAAATCCCANCAACCACATGGTGGCTCACAACC
ATCTGTAACGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI510 UNI4467 UNI32636

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 10276952..10277048 95
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 22309062..22309158 95
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 34803399..34803495 95
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 90263799..90263895 95
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 4069622..4069718 95
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022186 (Oxct1) NM_024188 3-oxoacid CoA transferase 1 Gene [Source:MGI Symbol;Acc:MGI:1914291]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 114789589..114789685 95
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042348 (Arl15) NM_172595 ADP-ribosylation factor-like 15 Gene [Source:MGI Symbol;Acc:MGI:2442308]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 84916176..84916272 95
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 6107846..6107942 95
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 12884756..12884852 95
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 56229004..56229100 95
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 60612784..60612880 95
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 26022162..26022258 95
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 39381307..39381403 95
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 16838617..16838713 95
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 20519065..20519161 95
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 4543727..4543823 95
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 94624257..94624353 95
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 71183112..71183208 95
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29766594..29766690 95
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026790 (Odf2) NM_013615 outer dense fiber of sperm tails 2 Gene [Source:MGI (curated);Acc:Odf2-002]


Sequence tag IST13606D12HMF2
Sequence
TCAGTGGGTAAGAGCACCCGACTGCTCTTCCGAAGGTCCAGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCAT
CTGTAACGAGATCTGATTCCCTCTTCTGGAGTGTCTGAAGACAGCTACAATGTACTTACATATAATAAATAAATAAATCT
TAAAAAAAAAAAAAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 10276954..10277138 185
 
EST/CDNA Est Name
  AW229948.1 - BE226930.1

 
Come back to gene AW229948.1 - BE226930.1


For any suggestions or comments, please send an email to unitrap@crg.es