Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14401F1
Clone ID IST14401F1
Vector VICTR74
Project tigm

Sequence tag IST14401F1HMF1
Sequence
AGGGCNACACCTAGGCCTGGCTGGGGAGGGTTTTCACTGTAGATATGAGGAAGAGGACAGCCAAGCACAAGGACGGGTCC
AGTGTGAACGTGGCCNGCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30982727..30982824 94
NO GENE  


Sequence tag IST14401F1HMR1
Sequence
CCCTGTTCTNATCGTCATTCAGGTCCTGCCTTCTGAGAAGGGATGCCGCCGCTCTGGCAGANTAACTCATCTTGCTAGCA
AGAGTGAGGGCAAGCCTTCCCAAAGCACTGTCCCTCTTCCATGTCCTTAGTCCTGGGCTGCCACCAGGAGGTGTGTCACC
CACATTTAAAAATGGGTATTTATGATTCCAAAAAAATGTAAACAAAAAGATCCCTCCCAGGAGTGCCTGGCTGCCTANGA
TTTCNTCNATTACN
Sequence Type genomic DNA
Unitrap ID UNI29473

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30982478..30982730 243
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]

 
Come back to gene ENSMUSG00000075415


For any suggestions or comments, please send an email to unitrap@crg.es