Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14939H6
Clone ID IST14939H6
Vector VICTR76
Project tigm

Sequence tag IST14939H6HMF1
Sequence
CTATATACATTACCAACAACTCTCTTCAGTGCATATATTCTACTTACAGACTCAAAAGCTTGTTGGTTTTCCTTCATATA
TGAGACACAAGCTCTCCTGATCTGTAAATGATGGATCTGGCTGTGAAACAACTATAAAAAAAAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 140771621..140771765 145
NO GENE  


Sequence tag IST14939H6HMR1
Sequence
GAGATACCAGCACCATGGGGGTGTCCACCAAGAATAGCAGCAGCAGTGGAGTANAGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 70247853..70247910 56
NO GENE  


Sequence tag IST14939H6BBF1
Sequence
AGCTTTATTAAATACTGGTCAGGAGGAGGGACACTGGCTGGGTCCATCCCCAGAATATCCTGAGAATAACTGTGAATTAT
GTTAGGTGCTTACAGAGGCAAACCCCACAAGGCTATGGACTTCTGTCTTCATCCAACTGGGGGGCAAGCATGTATTCTGA
CATTTCCTGCCTTCATACCTCCCACCTACTTGTGATCAAGCACAAGCTGTGCAGTTGGGACAACCAAGCTTGTCTACAGA
CGTGAGAACACGTGGCTTGTTTTCCTAGATGAACAGCCCCGGGCATCCCAGGAAGCTCTCTCTCCTTANGCAAGTGGGGA
GCGCAGGTTAGGGGCATTTCTGTTTTATANATCTG
Sequence Type genomic DNA
Unitrap ID UNI12962

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96492646..96492999 350
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038354 (Ankrd35) NM_001081139 ankyrin repeat domain 35 Gene [Source:MGI (curated);Acc:Ankrd35-001]

 
Come back to gene ENSMUSG00000038354


For any suggestions or comments, please send an email to unitrap@crg.es