Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15069B7
Clone ID IST15069B7
Vector VICTR80
Project tigm

Sequence tag IST15069B7HMF1
Sequence
ACCTGTGGGGTGTTTTTGACACAGTCCTCCATCAGCTAAATGCTACTTACTGTCACTATTTCCTAAGCTTGGTAAACCCT
TTACATCATCAATTCTACTCTTCTACATCTCAGCTTAACATGGGAGTGCTACCCAACACATGAGATGCCTTTTAACAGCT
CCACAAAATTAACTACAAATGGATCTTATACTTAATAGGTAAATGCTGGGGGCAAAACTTATAGAAGATTCAAGAGAAAC
TAGGGCTTTCCATGTTTGGCATCCTGCCCGTGATATTTCTACAAGCAAGCCCCTAATCCTAATGTTTTGAGCTGATTCAG
CCCTGATACTGATGTTATTCAGAGTTCACCGCCTGTTTTAGCAAGTGAGGAGCATCACAAAGGTCCGCACAATTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 74630783..74631178 396
 
EST/CDNA Est Name
  BM947391.1 - CN684765.1 - CB237617.1 - BB690745.1 - CJ313043.1 - CK335385.1 - AI508532.1


Sequence tag IST15069B7BBF1
Sequence
ACCTGTGGGGTGTTTTTGACACAGTCCTCCATCAGCTAAATGCTACTTACTGTCACTATTTCCTAAGCTTGGTAAACCCT
TTACATCATCAATTCTACTCTTCTACATCTCAGCTTAACATGGGAGTGCTACCCAACACATGAGATGCCTTTTAACAGCT
CCACAAAATTAACTACAAATGGATCTTATACTTAATAGGTAAATGCTGGGGGCAAAACTTATAGAAGATTCAAGAGAAAC
TAGGGCTTTCCATGTTTGGCATCCTGCCCGTGATATTTCTACAAGCAAGCCCCTAATCCTAATGTTTTGAGCTGATTCAG
CCCTGATACTGATGTTATTCANAGTTCACCGCCTGTTTTAGCAAGTGAGGAGCATCACAAAGGTCCGCACAATTGGCCAC
ATCTGGTTACATCTGGCTGANGCTTCCNATCCAGCCCCAGANAGGANCCACCACCTCANCTCCCACTGCTNNNCCNCCTG
CCCCTATCCNTTATANACNGTAACCATGCNCTNANCATGTTTNNAAAACGNANCTNANTTGACNTCCCCTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15069B7HMR1
Sequence
GGTTAGTATGCTAAGCAGGCCGGTTAGAGACTAGGATGCTAGGATTCACATGTTAGCTCACCAGGTTTGTCTACACAGCT
GGCTCCAAACTATAACAAAGGAGAGACAACTGTGATGTACAATCAGCCACTTGGCCCATGCTCAAAGCAAAAAGCAGGTC
TGTAACAAGCTGCTCAATCCATCCTTAACAGAGTCACAACCAACATGAAGGCCTGGTGTGCCTAAAGCTCCCATTGTCTA
ATTGAGAAAAGCATTGTTCTGCCACTCCACTGGTTC
Sequence Type genomic DNA
Unitrap ID UNI35925

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 74630511..74630785 275
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069208 (Zfp825) NP_666343 zinc finger protein 825 Gene [Source:MGI Symbol;Acc:MGI:2385315]

 
Come back to gene ENSMUSG00000069208


For any suggestions or comments, please send an email to unitrap@crg.es