Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11069B8
Clone ID IST11069B8
Vector VICTR76
Project tigm

Sequence tag IST11069B8BBF1
Sequence
CCACGTGTGTTTGCTGTGTTTGTGGAGCCCAGAGGAGGGTGTCAGGTTTCCCTGGCACTGGAGTTACAGCACTTTGTGAG
CTACCATATACGCTCTGGGATCAAACACAGGACCCCTGCAAGAGCAAGTGTCCTCAACCTGCTGAGTCACCTCCCGACCC
CTAAAATGATAATTAAAAAAAAATACATTTATCTATTTATTTTGGTGTTCTGANACAGGTTCTGCTCTCTCTGGANCCCA
GGCTAGCCTTGAATTGCCTCANCCTCCTGANTTGCTAGGACCGCACCTGCCTGTTTGAGCGCATTGTCCAGGTTGAAAGT
GCTATTGAGGGAGGTGAANAGATTTTCCCAAGGTTACCCANCCNCCGAATGGTGAGGTTGGCCNGCCGTGTGTGTGTGTG
TGTGTGTGTGTGTGTGTGTGTGTGTGTGN

Sequence Type genomic DNA
Unitrap ID UNI30528

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79459395..79459822 412
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017639 (Rab11fip4) NM_175543 RAB11 family interacting protein 4 (class II) Gene [Source:MGI (curated);Acc:Rab11fip4-001]


Sequence tag IST11069B8HMF1
Sequence
CCACGTGTGTTTGCTGTGTTTGTGGAGCCCAGAGGAGGGTGTCAGGTTTCCCTGGCACTGGAGTTACAGCACTTTGTGAG
CTACCATATACGCTCTGGGATCAAACACAGGACCCCTGCAAGAGCAAGTGTCCTCAACCTGCTGAGTCACCTCCCGACCC
CTAAAATGATAATTAAAAAAAAATACATTTATCTATTTATTTTGGTGTTCTGAGACAGGTTCTGCTCTCTCTGGAGCCCA
GGCTAGCCTTGAATTGCCTCANCCTCCTGAGTTGCTAGGACCGCACCTGCCTGTTTGAGCGCATTGTCCAGGTTGAAAGT
GCTATTGAGGGAGGTGAANAGATTTTCCCAAGGTTACCCAGCNNCCGAATGGTGAGGTTGGA

Sequence Type genomic DNA
Unitrap ID UNI30528

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79459395..79459775 373
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017639 (Rab11fip4) NM_175543 RAB11 family interacting protein 4 (class II) Gene [Source:MGI (curated);Acc:Rab11fip4-001]

 
Come back to gene ENSMUSG00000017639


For any suggestions or comments, please send an email to unitrap@crg.es