Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12277F7
Clone ID IST12277F7
Vector VICTR76
Project tigm

Sequence tag IST12277F7HMF1
Sequence
CTATTAGCGGTATAAAGGATGTTCTCTTTATCTTTTATCAGCAAATGCTCATTTGACAGTTTAAATATTGAAAGACAGCC
TAAGGAGAAAATATTTCAAAGTCTTTTAAAGAGGGGAGA
Sequence Type genomic DNA
Unitrap ID UNI18681

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 17544517..17544634 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047786 (Lix1) NM_025681 limb expression 1 homolog (chicken) Gene [Source:MGI (curated);Acc:Lix1-001]

 
Come back to gene ENSMUSG00000047786


For any suggestions or comments, please send an email to unitrap@crg.es