Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14241A7
Clone ID IST14241A7
Vector VICTR74
Project tigm

Sequence tag IST14241A7BBF1
Sequence
GTCCTGCCTTTCTGGTATTTTCTTTTACTTCCATTTCCTAGCCTAGTGAATTGGTTTTGTTTGTTTGTCTTAACACAGTC
TCCAGTAGCTGAGGCTATCATTAGTATGGAGCAGAGGATGGCCTCCTGTCTCTTCTTCCCATCTACCACCATCCCTGACT
TAGGTGGTGCTGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88252948..88253124 177
NO GENE  


Sequence tag IST14241A7HMR1
Sequence
NNNAANNAAATAAAACANTGATAAAACAAAGACATGGTGGTGAGGAAGGAAGATCAGGAGTTCAAGGACTAATGCCTCAA
AAATAAACAAGGGCTGGGGATGTAGCTCAGTTGGTAGAGCATTTGCCTAGCATGCACAGAGCCCTGAGTTGGATCCCAGC
ACCACCTAAGTCAGGGATGGTGGTANATGGGAAGAAGAGACAGGAGGCCATCCTCTGCTCCATACTAATGATAGCCTCAG
CTACTGGANACTGTGTTAANACAAACAAACAAAACCAATTCNCTANGCTANGAAATGGAAGTAAAAGAAAATACCANAAA
GGCAGGACAAGGGTCTGTANCGCTCAAATGCTATTGTAAAACTAAACACAGGCTGATGANATGGCTCNNCTGTTCNNAGC
ACTGACAGCTCTTCCAGANGTCCTGAGTTCAATTCNATACCCACATGGTGGCTGACAACCACCTGTAATGGAATCTGATG
TCCTCTTCTGATGTGTTTGANGACAGCTACNTATACTGTACTGTCCANTGTACTCATATNCNTAAAAA
Sequence Type genomic DNA
Unitrap ID UNI35927

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88252729..88253268 498
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028064 (Sema4a) NM_013658 sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A Gene [Source:MGI (curated);Acc:Sema4a-001]


Sequence tag IST14241A7HMF1
Sequence
GTCCTGCCTTTCTGGTATTTTCTTTTACTTCCATTTCCTAGCCTAGTGAATTGGTTTTGTTTGTTTGTCTTAACACAGTC
TCCAGTAGCTGAGGCTATCATTAGTATGGAGCAGAGGATGGCCTCCTGTCTCTTCTTCCCATCTACCACCATCCCTGACT
TAGGTGGTGCTGGGATCCAACTCAGGGCTCTGTGCATGCTANGCAAATGCTCTACCAACTGAGCTACATCCCCAGCCCTT
GTTTATTTTTGAGGCATTANTCCTTGAACTCCTGATCTTCCTTCCTCANCACCATGTCTTTGTTTTATCAANGTTNTATT
TTGTTTGANACNNCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88252948..88253278 319
NO GENE  

 
Come back to gene ENSMUSG00000028064


For any suggestions or comments, please send an email to unitrap@crg.es