Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14035H8
Clone ID IST14035H8
Vector VICTR74
Project tigm

Sequence tag IST14035H8BBF1
Sequence
TGGGAGGAACCAAACCCTGGTCCTCAGGGACAGCAGCAAATGCTTAAACTCAGGGCAGTCTCTCCAGCCNNNNNGAAAGA
GGCATATGTTGATGCTTGGTTACTGTTTCCATTTAAATTAAGAGGAAAAAAAAAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI13061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84860728..84860869 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]


Sequence tag IST14035H8HMF1
Sequence
GTGGGAGGAACCAAACCCTGGTCCTCAGGGACAGCAGCAAATGCTTAAACTCAGGGCAGTCTCTCCAGCCGGACTGAAAG
AGGCATATGTTGATGCTTGGTTACTGTTTCCATTTAAATTAAGAGGAAAAAAAAAAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI13061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84860727..84860870 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]

 
Come back to gene ENSMUSG00000073633


For any suggestions or comments, please send an email to unitrap@crg.es