Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15076F8
Clone ID IST15076F8
Vector VICTR80
Project tigm

Sequence tag IST15076F8HMF1
Sequence
ATTGTATTACTTAAGCAACTCTTCTATAGGTTTGAAACTTTCCAAAATGGATCCTCGGAGGAAGGAACACCANTCANCCC
NNNNNNNNTNNNNNCNTTGGGAANANANTTTNANCCNNCAATAATAATTTGACAGTTTAATTCGTTGAGTGTCTGGTGAG
CCTTCCGTGTTGGGAGTGGGAACTCTTGGGCTGTAGCTGTCCAATGTCCACACTTCCAGGGTACAGATGTTTCGCTCCAC
TGACCTGTAGGGTGAGAGGTCCTGGTTTGATGTGCTGACTCAGCAAAGTGCACTGGCTGAAGTTCATGCCTTGNCANCCT
GCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15076F8BBF1
Sequence
ATTGTATTACTTAAGCAACTCTTCTATAGGTTTGAAACTTTCCAAAATGGATCT
Sequence Type genomic DNA
Unitrap ID UNI30181

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104125941..104125993 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]

 
Come back to gene ENSMUSG00000018411


For any suggestions or comments, please send an email to unitrap@crg.es