Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST455329
Clone ID OST455329
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST455329
Sequence
GACTGAGAAGATGGACGACATGTCGCCCAGGCTGAGAGCCTTTCTCTCTGAACCCATTGGGGAAAAGGATGTGGCCTGGG
TGGATGGCATCAGCCGTGAACTTGCCATCAATTTGGTCACCAAAGGTTTCAACAAGGCCTATGTCCTGCTGGGACAGTTT
CTTCTGATGCACAAGAATGAAGCAGAGTTCCAGAGGTGGATCATCTGCTGCTGTGGAGCTACGGAGTGTGAGGCCCGCCA
GAGCTCCACCTGCCTGAAGGAGTGGTGCTCCTGTTTCCTATAGATATCTCTGGCCTGGCAGCTCTACCTCAGATAAAGGC
TACCCATGCTACCTACAGACAAC
Sequence Type mRNA
Unitrap ID UNI16736

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 143891139..143899709 209
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037307 (Banf2) NM_207275 barrier to autointegration factor 2 Gene [Source:MGI (curated);Acc:Banf2-001]

 
Come back to gene ENSMUSG00000037307


For any suggestions or comments, please send an email to unitrap@crg.es