Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14862H10
Clone ID IST14862H10
Vector VICTR76
Project tigm

Sequence tag IST14862H10HMF1
Sequence
ACACCTGGCAACCAAGGAGTGAGGTACCAGCCAGGAAGGTGGGATGGGCTCAGGCTCTTGGGATTCAAGGGAAGACTCAT
GGCCTGGAAGGGCCCAAGGAGACCTTGTCCTGGCAGTAGCTGAGAAAGTGCCTAAGGGAAAGCTTTAGGCACTACAGCCA
CAAGCTGGTTCTGCAGGCTGAGGGGCTGAGGCTGTAGATTCAAAATAGGTTGGGGTGGTCTGGANTCACTGAGGCCCCTT
GGCTTGTNNACCTAGATCNTCNACTGNTCCTGATNNTGTTNNTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 109047727..109048007 261
 
EST/CDNA Est Name
  BG067287.2 - EH097107.1 - BE627905.1 - C86465.1 - C85794.1 - BX640244.1 - AW740571.1 - AW490362.1 - BE946945.1 - BU758129.1 - CK032133.1


Sequence tag IST14862H10HMR1
Sequence
GTGTGGTCCCTTTCTAGCCCTCTTTAATAAAGACACAGGACTGATTGTTTCCCCAATGTCTATTCCCTGTTTGTTGGTGG
GACCCAGAGTTCAGAATCTTTTCTTGGACATTGGGACGGGGTTATGTAAGGACTCTCAAGCAAACCTAATGGACCATGTT
GGCCN
Sequence Type genomic DNA
Unitrap ID UNI35686

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 109048004..109048167 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030649 (3200002M19Rik) NM_027532 RIKEN cDNA 3200002M19 gene Gene [Source:MGI Symbol;Acc:MGI:1922680]

 
Come back to gene ENSMUSG00000030649


For any suggestions or comments, please send an email to unitrap@crg.es