Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11040F7
Clone ID IST11040F7
Vector VICTR76
Project tigm

Sequence tag IST11040F7BBF1
Sequence
CTTTCCGCCACCTGAAACTTCTGTGTGCCATCCCCACCTCGCTGTCGCCTCTCTTCTGCCACTCCTAGGTTCCTCAGGCC
ACTGCTGTGTCGTGCTGTAGCCTCCTGGAGACAACAGGCTCGGAGATGCTCGGAGCATCCCTGGCCTCCCTTCACGCACA
GGCGCCTCCCGCTTTCCGTGTGTCCATCCTCTCAAAAGGATGATGTTCTAAACGTTGGGTTTTTTTTTCCCCCNTCGNTN
NCAA

Sequence Type genomic DNA
Unitrap ID UNI35932

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110737327..110737563 235
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047257 (BC107230) NM_153172 Inactive testis serine protease 5 Precursor (Trypsin-like protease p98) [Source:UniProtKB/Swiss-Prot;Acc:Q8K4I7]


Sequence tag IST11040F7HMR1
Sequence
AAAGGAAAGGAATAGCCNCCTGAGCAAGACTGGAGGGGAGAGGACACAGAAAGAAAGGACAATGGAGAAGGAGGTGCCTG
CCTGACCTAAGTTTGGCCGCGGAGGCAGCAACAGTAGCGCCGCAAAGCAGATTAGGATCCAGCGCCTCAAGGATCCAGGC
CCAGCGTCCAGGCCGCGCAATGACGTANCCATACATGAATATTGTCCCTAAGGGCAGCAGAGATAGCTGCGGCGTGCTGT
CACGTGCCCACATCCAAGTNNNCGATGGCGTCTTCNACACATGACTGACCTGGCGCCAAGAGCCTGANNGTGCCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110737015..110737330 294
NO GENE  

 
Come back to gene ENSMUSG00000047257


For any suggestions or comments, please send an email to unitrap@crg.es