Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14346D11
Clone ID IST14346D11
Vector VICTR74
Project tigm

Sequence tag IST14346D11HMF1
Sequence
TGGGGACACTTGAGGAAAATGGTACATAATTGCTTAAATCAAAGTCATCTTACTGGAGAGAAATAAGATGATCTATAGAC
ACGCCATTTTGGAAAAAAAATTGTGTGCGTTGTGGATGCTCTTAAAAATTCTGCCAGGGGTTTTTGGAACATTGTATGTA
ATGCCAGTACTCGGGAGGTGGACGTATGAGGATCACAAATCCAAAAGTANCCTGGGCTACACACAANACCCTGTCTAAAA
ATGAAAAACAAAAGCAAAAAACACTCATGGCTGGAAATGTANCTCCAAGGTANAGCTCTTCTCTAGCGTGTCCAAGGCCC
TGTGCTCCATCTTCAGCTCCGGGGGGAAAAGGGGAAAAAGCTTGGANCAGAACACANCANAAGCAAAACAAACGCTAGAN
ATCCTTTCCGGCTGGANAACANGGAANGACNTTNNATNNNANNNTTTACNNNANAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 101391662..101392094 407
 
EST/CDNA Est Name
  BY730463.1


Sequence tag IST14346D11BBF1
Sequence
TGGGGACACTTGAGGAAAATGGTACATAATTGCTTAAATCAAAGTCATCTTACTGGAGAGAAATAAGATGATCTATAGAC
ACGCCATTTTGGAAAAAAAATTGTGTGCGTTGTGGATGCTCTTAAGAATTCTGCCAGGGGTTTTTGGAACATTGTATGTA
ATGCCAGTACTCGGGAGGTGGACGTATGAGGATCACAAATCCAAAAGTANCCTGGGCTACACACAAGACCCTGTCTAAAA
ATGAAAAACANANGCAAAAAACACTCNTGGCTGGAAATGTANCTCCNAGGTANAGCTCTTCTCTAGCGTGTCCAAGGCCC
TGTGCTCCATCTTNNNCTCCGGGGGGAAAAGGGGAAAAAGCTTGNANCAGAACANANCNCAAGCNNNNCAAACGCTANAA
ATCCNTTNCNGCTGGANNACANNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14346D11HMR1
Sequence
CCCAAANCCTATGAAAACTATCAGTTTCATTCTCCCATTGTTTTTTTCAAGTGTCCCACAAACTAGCTGGAGAAAGAAGC
TTCTGCTGTCTATCTGCANATTATCTAAAGGCTGGAGAACAAGATTTGTACACTGCATCTAAACATAGGAATTTTGACCC
ACCCTCCATCAAGAACAAGCATAAACCCANATGTGGTATAATCCCCCACACAAGAGGCTGAGAGGCAAGAANATCCTGAN
CTTGAGGTCC
Sequence Type genomic DNA
Unitrap ID UNI30077

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 101391417..101391665 239
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046449 (C77370) NP_001070822 Uncharacterized protein KIAA2022 [Source:UniProtKB/Swiss-Prot;Acc:Q5DTT1]

 
Come back to gene ENSMUSG00000046449


For any suggestions or comments, please send an email to unitrap@crg.es