Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11922E4
Clone ID IST11922E4
Vector VICTR76
Project tigm

Sequence tag IST11922E4BBF1
Sequence
NNNNNNGCTTGGTTACTGNNCNNGTCTANATTTTTTTTCCNTGTNAAAATATGCNTTATGTTCTTTTTGTTTGTTTTGTT
GTTTTTCTANACAGGGTTTCTCTGGGTAGCTCTGGCTGCCCTGTAACTCNTTCTGTANGCCAGGCTGCCCTCNAACTCAG
ANATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11922E4HMF2
Sequence
AGGGTTTCTCTGTATAGCCCTGGCTGTCCTGGG
Sequence Type genomic DNA
Unitrap ID UNI6913 UNI13860 UNI32787 UNI32793 UNI32794 UNI32795 UNI32796 UNI32797

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166447: 15425..15457 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 6655631..6655663 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 10642725..10642757 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 28678562..28678594 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 32120049..32120081 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 58747135..58747167 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050891 (Tatdn1) NM_175151 TatD DNase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1916944]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 37336389..37336421 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 58896123..58896155 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 13738112..13738144 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 30816922..30816954 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 15366415..15366447 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6177068..6177100 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 17387029..17387061 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060924 (Csmd1) NM_053171 CUB and Sushi multiple domains 1 Gene [Source:MGI Symbol;Acc:MGI:2137383]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 11974036..11974068 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029629 (Phf14) NM_029404 PHD finger protein 14 Gene [Source:MGI (curated);Acc:Phf14-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 29769936..29769968 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037337 (Map4k1) NM_008279 mitogen-activated protein kinase kinase kinase kinase 1 Gene [Source:MGI Symbol;Acc:MGI:1346882]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 69962141..69962173 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029208 (Guf1) NM_172711 GUF1 GTPase homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Guf1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 21167844..21167876 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 63174567..63174599 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027820 (Mme) NM_008604 membrane metallo endopeptidase Gene [Source:MGI Symbol;Acc:MGI:97004]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 57651276..57651308 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062949 (Atp11c) NM_001037863 ATPase, class VI, type 11C Gene [Source:MGI Symbol;Acc:MGI:1859661]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 55388746..55388778 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026824 (Kcnj3) NM_008426 potassium inwardly-rectifying channel, subfamily J, member 3 Gene [Source:MGI (curated);Acc:Kcnj3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 14113755..14113787 33
NO GENE  

 
Come back to gene ENSMUSG00000026824


For any suggestions or comments, please send an email to unitrap@crg.es