Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14240A9
Clone ID IST14240A9
Vector VICTR74
Project tigm

Sequence tag IST14240A9BBF1
Sequence
GATTTATTTATTTATTATATGTAAGTACACTGTAGCTGTCTTCAGACACTCCAGAAGAGGGCGCCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI8340 UNI34559 UNI34560 UNI34561 UNI35933 UNI35934 UNI35935 UNI35936

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 856668..856738 71
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 6434533..6434603 71
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033768 (Nrxn2) NP_064649 neurexin II Gene [Source:MGI (curated);Acc:Nrxn2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 52796639..52796709 71
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035580 (AC131674.2) NP_001026981 Potassium voltage-gated channel subfamily H member 8 (Voltage-gated potassium channel subunit Kv12.1)(Ether-a-go-go-like potassium channel 3)(ELK channel 3)(ELK3) [Source:UniProtKB/Swiss-Prot;Acc:P59111]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 33103164..33103234 71
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022802 (Lmln) NM_172823 leishmanolysin-like (metallopeptidase M8 family) Gene [Source:MGI (curated);Acc:Lmln-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 19971772..19971842 71
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 70833478..70833548 71
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 70314634..70314704 71
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 5851187..5851257 71
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 15106583..15106653 71
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 62183830..62183900 71
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 28088494..28088564 71
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019889 (Ptprk) NM_008983 protein tyrosine phosphatase, receptor type, K Gene [Source:MGI Symbol;Acc:MGI:103310]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 4598421..4598491 71
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 52072755..52072825 71
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 19774859..19774929 71
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040811 (Eml2) echinoderm microtubule associated protein like 2 Gene [Source:MGI (curated);Acc:Eml2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 67675553..67675623 71
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037720 (Tmem33) NM_028975 transmembrane protein 33 Gene [Source:MGI (curated);Acc:Tmem33]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 154480996..154481066 71
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029049 (Morn1) NM_001081100 MORN repeat containing 1 Gene [Source:MGI (curated);Acc:Morn1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 3116779..3116849 71
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 46022555..46022625 71
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 120963029..120963099 71
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 60498391..60498461 71
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026782 (Abi2) NM_198127 abl-interactor 2 Gene [Source:MGI Symbol;Acc:MGI:106913]

 
Come back to gene ENSMUSG00000026782


For any suggestions or comments, please send an email to unitrap@crg.es