Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14655B5
Clone ID IST14655B5
Vector VICTR74
Project tigm

Sequence tag IST14655B5BBF1
Sequence
CCTCCTCGCTGCTGATGTTGCCACGAGCGAAGGCTTCGCAGACCGGAGGTGAGCACAATGCGCGGCTCACCGCCCACTGG
AAGAGATCCGAGATGTTGCGGCGCCAGGGCAGGTAGGCATCAAATACGTCCATGTCGCATAGGAACACTGAGCGGATCAG
GTCACGCACGGCCATGTGGAGTGCGGGGGCACTGCCCTGCGACAACGTATCCCANACGTGCCAAGCCGGCTCCATCAGGT
AGAAGACATCNGGGTGTTGGCTGAANANCTGGCCCACGAAGGACNAGCCCGAGCGCCNCNANGACNGTACCNNNNNGTGC
NCACGCTCCCCANGGCCTGNTGGGGACNATGGCNCNTNCCGGGAGANNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14655B5HMF1
Sequence
CCTCCTCGCTGCTGATGTTGCCACGAGCGAAGGCTTCGCAGACCGGAGGTGAGCACAATGCGCGGCTCACCGCCCACTGG
AAGAGATCCGAGATGTTGCGGCGCCAGGGCAGGTAGGCATCAAATACGTCCATGTCGCATAGGAACACTGAGCGGATCAG
GTCACGCACGGCCATGTGGAGTGCGGGGGCACTGCCCTGCGACAACGTATCCCAGACGTGCCAAGCCGGCTCCATCAGGT
ANAANANNTNNNNGTGTTGGCTGAAGANCTGGCCCACGAAGGACNAGCCCGANCGCNNCNAGGACNGTNCCNNCNCGTGC
ACNCNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14655B5HMR1
Sequence
TGCTCAGCGACCCTGCGCTCAACCTGCGCATCGTGCACCTAGTGCGCGACCCGCGGGCCGTGCTGCGCTCCCGAGAGCAN
ACAGCCNAGGCGCTGGCACGGGACAATGGCATCGTCCTGGGTACCAACGGCACGTGGGTGGAGGCGGACCCCCGGCTGCN
CNTGGTN
Sequence Type genomic DNA
Unitrap ID UNI14352

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114414162..114414327 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031952 (Chst5) NM_019950 carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5 Gene [Source:MGI Symbol;Acc:MGI:1931825]

 
Come back to gene ENSMUSG00000031952


For any suggestions or comments, please send an email to unitrap@crg.es