Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10228H4
Clone ID IST10228H4
Vector VICTR76
Project tigm

Sequence tag IST10228H4BBF1
Sequence
GCAGAGGCAGGCGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAAAGTGAGTGCCAGGACAGCCAGGGCTACACAGAGA
AACCCTGTCTCAAAAAAAAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI11537 UNI31529

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29141562..29141669 108
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024006 (Stk38) NM_134115 serine/threonine kinase 38 Gene [Source:MGI (curated);Acc:Stk38-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 50030209..50030316 108
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 87992393..87992500 108
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020061 (Mybpc1) NP_780627 myosin binding protein C, slow-type Gene [Source:MGI (curated);Acc:Mybpc1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 75494572..75494679 108
NO GENE  

 
Come back to gene ENSMUSG00000020061


For any suggestions or comments, please send an email to unitrap@crg.es