Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10922E1
Clone ID IST10922E1
Vector VICTR76
Project tigm

Sequence tag IST10922E1HMR1
Sequence
CCAGTAACTCAGNCTGAAGACTAAGCTAGCTGCAAAGTTACAGTGATCCACCTCCCTCTGCCACCACCACCACCACTGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3005269..3005344 72
NO GENE  


Sequence tag IST10922E1HMF1
Sequence
TGTCTATTTCCCTGCCAATAACTCCACAATATGACTTGCCATGTTCCATCTGGGCTGCTCTTAACTCCAATGGA

Sequence Type genomic DNA
Unitrap ID UNI14552

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 14021150..14021222 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044117 (2900011O08Rik) NM_144518 RIKEN cDNA 2900011O08 gene Gene [Source:MGI Symbol;Acc:MGI:1914504]

 
Come back to gene ENSMUSG00000044117


For any suggestions or comments, please send an email to unitrap@crg.es