Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12475A2
Clone ID IST12475A2
Vector VICTR76
Project tigm

Sequence tag IST12475A2BBF1
Sequence
AGGAAGGTGGAGCCTTAAGGAAACCAATGCTATTCGTTTTAAAGGCTTGGATTTTGGAAAGAAAAGTGTGGCTGGCTGAC
AGCTTGTTCCCACCCTATTTTTGTGCATGGGAGTATCCACACATATCCTTCAGTAAAGGGAACCAAGCATGGTTTATAGA
CAGGGAATTGGGGCTAACGGAATTCCCTCCCAAAAGAATGAGGACAGCTGCTTCCACTAGCTTCCTCTCACTGACAGCCC
GGAGCACACACTCTGATGTGCAAAGTGATGAANATGAAATTACGTGTTTAGGGACTTGTAGGAATTTGCATGTAAATGTG
TACAGCATGCACATACTTCCAATGCAACCATTACGCATGTGCTCTGTATGGATTTCACATGCCTCCCTGTGCTTTANCAT
CACTGATGTGANNGANGAAATGGAATGTCTAGCAACGGTTCTTTCTACGCACATGTNTTATGAATANGTTCTTANGTATG
AAATGGTTATGTGCCTCCATGTNGCAACATTACTTGTCNTTTNCN
Sequence Type genomic DNA
Unitrap ID UNI25563

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 42338281..42338802 502
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047261 (Gap43) NM_008083 growth associated protein 43 Gene [Source:MGI (curated);Acc:Gap43-001]

 
Come back to gene ENSMUSG00000047261


For any suggestions or comments, please send an email to unitrap@crg.es