Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14899G3
Clone ID IST14899G3
Vector VICTR76
Project tigm

Sequence tag IST14899G3HMF2
Sequence
ATAGGACAATGAAAAGAAATAAAAACCTCCAGGCAAGGACGCACACCTCCCTACCCAGCAGTAGAACTTTGAGGGCTGCA
AGATTAACAGCAACTCTCCCACTGACAGGTGCGCCCTGCAGCCGGGCTCACGCACGGCAGTACAGAAACTTGCACTAGCG
GCTGGAGCTCCTCCAATCTCTCCTAGGCACCCTTGGACCTCTCTGAACCGGCAAGGAGGAGGAACTCATCTCACAAACCT
GTGCTGTAGGGACCAGATCGCTGGAGATCTCGGTGTCCCCGCAGGTGTGAACCCCCTGCGGGCGTGAGTTGGGGGGAGGG
GCACTCTAGCCTCGCTCCCCGCACAGCCTCCCTCCACCCCCAATTCATTCACAAAACAAGAGCCGCAAGGGANGAAGGGA
GGAGAGGCTGCNGGANCCCAGGATGTCGGAAGAAANGGAGGANGGGGTNNGGAACATGGTGCAAGCNANTGCCNCCGGGN
ANCATTGAGCGGCCGGAGCCCCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109394900..109395402 479
NO GENE  


Sequence tag IST14899G3HMR1
Sequence
TATGGGACATGGNTCCCGTAAAGCGCCCCCACCCTCGTGCCCTTGAATCTAAGTGCGCCTTANCTAGCCTGGGCGAGCTT
TCTTGGATCTCTTTTGAGAGGATGGAGGAAGCGGCCCAGGATATAAGATCACATTCTGGTTC
Sequence Type genomic DNA
Unitrap ID UNI14765

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109395400..109395540 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031910 (Has3) NM_008217 hyaluronan synthase 3 Gene [Source:MGI Symbol;Acc:MGI:109599]

 
Come back to gene ENSMUSG00000031910


For any suggestions or comments, please send an email to unitrap@crg.es