Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST455043
Clone ID OST455043
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST455043
Sequence
TGAGATCCCAGATGAGCATGGCCGCCACTGCTGCTGTCAGTCCCAGTGACTACCTGCAGCCTGCTGCTGCTACTACCCAG
GACTCCCAGCCATCTCCCTTGGCCCTGCTTGCTGCGACATGTAGCAAAATTGGCCCCCCAGCTGTTGAAGCTGCAGTGAC
ACCTCCTGCTCCCCCCCAGCCTACCCCAAGGAAACTGGTCCCTATCAAACCCGCTCCTCTCCCTCT
Sequence Type mRNA
Unitrap ID UNI15411

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 96823178..96824757 149
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018678 (Sp2) NM_030220 Sp2 transcription factor Gene [Source:MGI (curated);Acc:Sp2-001]

 
Come back to gene ENSMUSG00000018678


For any suggestions or comments, please send an email to unitrap@crg.es