Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10885C7
Clone ID IST10885C7
Vector VICTR76
Project tigm

Sequence tag IST10885C7HMR1
Sequence
TTATAAAAACGTTGGGGACAGTAAACTCAAAGGCATTTCTCACAAGGCATCTAGCCTCGATCCTCTAGTGGGGACCCGAG
GGAAATAAGTCAATTATTGCACCATTTTGAAAACATTCTTCACAGACTCCTGTCTTCTTTCCTGGGGCCTTCAGTCACTG
TGGGGGCCAGAACTGGTGGCAGAGTCATTTTCCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 74844938..74845133 196
 
EST/CDNA Est Name
  BG276187.1 - AA024308.1


Sequence tag IST10885C7BBF1
Sequence
ATATTGTATATAAGACTATGACCGATTGTATTTCTATAAGGGAGACGATGGCATCTCTGCCGCCTGCTTNNTTTNTATAC
NACTTTTTTTNAATTAAANTTTTGGATCTTTGGAGGAATCACGGTAGTGGTGTGGCTGGGGATAGGGTAGGTCCTGAGGG
GACAGGGAGCATTCAGTGCCTGTGGCNNAGGTCACCANCTGCANCCCCCANCTGCCAAGGCCTGTGGGTTCNNTATAAAT
GTAAACATGGTGTTTTAGGATTGANCACNNGTTATTTTTAAGTCTGCTACTTNGANCCATAATTTGCCCCANCNNNNNNN
NNTGTATCCNAAGTGGNAAAAGCCTTGGCTCCNNTGATGTGGCTGACCATTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10885C7HMF1
Sequence
ATATTGTATATAAGACTATGACCGATTGTATTTCTATAAGGGAGACGATGGCATCTCTGCCGCCTGCTTCGTTTTTATAC
GACTTTTTTTTAATTAAAGTTTTGGATCTTTGGAGGAATCACGGTAGTGGTGTGGCTGGGGATAGGGTAGGTCCTGAGGG
GACAGGGAGCAGTCNGTGCCTGTGGA

Sequence Type genomic DNA
Unitrap ID UNI14418

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 74845133..74845317 183
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055148 (Klf2) NM_008452 Kruppel-like factor 2 (lung) Gene [Source:MGI (curated);Acc:Klf2-001]

 
Come back to gene ENSMUSG00000055148


For any suggestions or comments, please send an email to unitrap@crg.es