Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10358F2
Clone ID IST10358F2
Vector VICTR76
Project tigm

Sequence tag IST10358F2BBF1
Sequence
GTGCCATCCTTGAGCAATCACAGAGGTTGGCCCGGCTTCTGCCAGCTGCACAGTGGGTGGCGTGACACCCCCTTGCTGAT
CTTGACCTTGTATAGGAGGGCCGTGCTCATTGGCTTAGGGTGTCTGTGACCATTACTGAAACCACCCAAATGCCTGTGAC
CTGGCAGGTGGCAGGAAACCGAGAGGTCTTANAGACCTCTTTANTCTTTCTGTTGTAAATCGTATTTATGTAAAATAATT
TAAACTGGGACCAAGCTCCGAGGTATTTAATCCCANCACTCAGGAGACAGAGGCAGGCAAATCTCTGTGAGTTTGAAGCC
NNCCTGGTCTGCANAACAAGTTCTAAGACAGCANGGGCTACAANGANAANCNNTGTTTTTGTTAAGGGGGAGGGTCAACG
GGTTCTCTAGTACTANGGTGCTTATGCNNCAGTCACGGGGCCCTGGGCTTGCTCCCANGCATTAAAANGACAGAANANTA
NGTGANGGCTCGGTGANTGNGGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10358F2HMF1
Sequence
GTGCCATCCTTGAGCAATCACAGAGGTTGGCCCGGCTTCTGCCANCTGCACAGTGGGTGGCGTGACACCCCCTTGCTGAT
CTTGACCTTGTATAGGAGGGCCGTGCTCATTGGCTTAGGGTGTCTGTGACCATTACTGAAACCACCCAAATGCCTGTGAC
CTGGCAGGTGGCAGGAAACCGAGAGGTCTTANAGACCTCTTTANTCTTTCTGTTGTAAATCGTATTTATGTAAAATAATT
TAAACTGGGACCAAGCTCCGAGGTATTTAATCCCANCACTCAGGAGACAGAGGCAGGCAAATCTCTGTGAGTTTGAAGCC
NGCCTGGTCTGCANAACAAGTTCTAAGACAGCANGGGCTACAAGGANAACCCCTGTTTTTGTTAAGGGGGAGGGTNAACG
C
Sequence Type genomic DNA
Unitrap ID UNI14558

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5849452..5849851 382
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043488 (AC142098.2) Putative uncharacterized protein Fragment [Source:UniProtKB/TrEMBL;Acc:Q8CEY4]

 
Come back to gene ENSMUSG00000043488


For any suggestions or comments, please send an email to unitrap@crg.es