Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13330H12
Clone ID IST13330H12
Vector VICTR74
Project tigm

Sequence tag IST13330H12HMF1
Sequence
CTTTGTACCGATAAAACTGAGGTCCATATCTATTTACTTTAAACATTCAACATTTACCTAAGGCCAGCTCTGTCATCACC
GAGAATTTTCCTTCCTACGCTGGAAACTGTAGGTATGAAAAGTGTGGAAACATGTCAAAGATATGTCTGCATTTAATTAC
TGGTCCTGCCTTGACTTGGAAAAACACTATGATTTCCTTAAGGAAGCATCACATTTATAGTCTGAAAGTTTGTTTCACCT
TTTACTAACTAGAAACCTGACTTCCCGAAGGATCAGGTTTTAGGTTTCTTTCTATTTATTTTTTTTCTGATCTGTTAAAC
AGGGATGACAGACATAAATGACTAACACAGGAATATGTTAGACAGCAGATACTCAAAAGTCNATGCATTTGTTGATTACT
TCAAAGAAACAATTAAAATTCTTAAAGCACCCATAACATATTCTTAACTAANTNCNCNCACTCACAGTCCCCCCCN
Sequence Type genomic DNA
Unitrap ID UNI35169

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 98706639..98707114 462
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052572 (Dlg2) NM_011807 membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2) Gene [Source:MGI (curated);Acc:Dlg2-001]

 
Come back to gene ENSMUSG00000052572


For any suggestions or comments, please send an email to unitrap@crg.es