Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10922A10
Clone ID IST10922A10
Vector VICTR76
Project tigm

Sequence tag IST10922A10HMR1
Sequence
GTTCCATCCCAGANCTTAATAGCACATATTACTAGGCATTCAATATGCTGATATAAACTAATGACAGGAATTACATTTTG
AGCANCANAGTGAATGCGTAAGACATGAATTTAGACCATAATGTTTTCCACTCACTAGCTCTATGATACTGGAAGCCAAT
GCCTGTCTTTGTACATCACCTTCTTTCCATTTAGTGGGAAAAATATAACAGTTC
Sequence Type genomic DNA
Unitrap ID UNI33122

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 44178655..44178867 207
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039753 (Fbxl5) NM_178729 F-box and leucine-rich repeat protein 5 Gene [Source:MGI (curated);Acc:Fbxl5-002]

 
Come back to gene ENSMUSG00000039753


For any suggestions or comments, please send an email to unitrap@crg.es