Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14241G1
Clone ID IST14241G1
Vector VICTR74
Project tigm

Sequence tag IST14241G1HMR1
Sequence
ANGGGAAGANCTAATGCATGGTGGGTCCTTTGTTTGCAGTGAAGTGGAGTTCCCAGGGGTCTTCAGAATCCTCAAGCCAA
GAGTACAGCGTCTATGTGCTTTCTAGATAGTCCTTGTGTAAGCAATATTGGTCTTTTAATTGCGGCTTTCCAATGCAGAG
ACTGTTCACCTTACAACCCCCAGTTCATGGGTGTTCGCCATGCATGGTANCAAATAAACTGCTGCCGTCCAGCTGCAAGG
TCTCAACTTGTTTTTGGATGCAACCTAC
Sequence Type genomic DNA
Unitrap ID UNI10489

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110019031..110019296 262
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032480 (Dhx30) NM_133347 DEAH (Asp-Glu-Ala-His) box polypeptide 30 Gene [Source:MGI Symbol;Acc:MGI:1920081]

 
Come back to gene ENSMUSG00000032480


For any suggestions or comments, please send an email to unitrap@crg.es