Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15101H11
Clone ID IST15101H11
Vector VICTR80
Project tigm

Sequence tag IST15101H11HMF1
Sequence
TGGGCAGAGGGATCAGAAGTACAGGGTAATATTTGAGCTACAAAGATTGTTGATGAGCTANAAAGTGAAGTTGATGTANC
ATGGGGAAGGCTCAATCTGCTGGAAATGATTGCAGCAGGCATGACTAAGTTTAGACCCATGCCAGATATATTTTCTGATA
ATTTCCTGGTCTGTTGAACACACAGGAAACAAGTATAATAGTTATATTCACAGTTCAAACTATATAAGGTTGTCCTTGAA
NGTTGGTCNAGCANNAAATANTACNNNNACCNCNNATGATTTGACAGGCCTTANGANATGTNATCNNNTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15101H11HMR1
Sequence
CCCTCACCCCAGAATTCTAAGACTGTTGGCACTTGCCATCATGCCTGGTCTATATAGTGCTGGGAATTGAACCCATGATA
GTGTGCAGACTAAGCAAGCACTTTAGCAATTGAGCTACAATCCCTAGCCCCTGATGTCATTTTCAAGATAGCTAATGACA
TAGCAATAGAGATGACAGTAAAAATCATTACACATTGATCAATTGCACTGGCATCCACTATGAAGGGTTCAGGGTTCATG
CCTCCAGAGGTGCAGCAAACCCACTATGGAAAGCTGTAGGAGCTGACATCTTTCTACTTCAAAGTGGATCTGTGGCTCCT
ANCTTTCCAGGAACATCCTGGGTGGATGCCTATGGTCCTACCTCTCCTTANCANAANCAGGTACAGCCTTTATCTGGCTG
GGGTCTCTGANTTGGGTGGTCAAATGAGTTCTCATATGCCTCATACATATCCCCTCCCTGTTGGTTACTCCAGCCCTGAN
TAGATGGTGCTTGAGANTGTCTCANCANANGCTGGCTTGATNAAACCTCCCTTAAATGTCNNNTTG
Sequence Type genomic DNA
Unitrap ID UNI12212

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 44882067..44882606 518
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071856 (Mcc) NP_001078843 mutated in colorectal cancers Gene [Source:MGI Symbol;Acc:MGI:96930]


Sequence tag IST15101H11BBF1
Sequence
TGGGCAGAGGGATCAGAAGTACAGGGTAATATTTGAGCTACAAAGATTGTTGATGAGCTAGAAAGTGAAGTTGATGTAGC
ATGGGGAAGGCTCAATCTGCTGGAAATGATTGCAGCAGGCATGACTAAGTTTAGACCCATGCCAGATATATTTTCTGATA
ATTTCCTGGTCTGTTGAACACACAGGAAACAAGTATAATAGTTATATTCACAGTTCAAAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 44882604..44882821 218
NO GENE  

 
Come back to gene ENSMUSG00000071856


For any suggestions or comments, please send an email to unitrap@crg.es