Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13200C2
Clone ID IST13200C2
Vector VICTR74
Project tigm

Sequence tag IST13200C2HMR1
Sequence
GACGTGCATCTTGCAGGCACAGACCCCTGGGAAATACGCTAAAGCTTTCTTCAGTTCTCTAAATGTTCCACAAACAAGGA
CCAATAAATATTAAATAGCACTGAGAGCAGATTCGGAGGTTAAGCATCAATGAATTTACACAAGTCTTGTCCTTGCATAA
GTTTAATTTTAATATGACTTCTCCGTAACCTGATGGCCCTATTTCGTGAATGGAAATCACAGTAATTCAAGGAGGGTAAG
AATATAATATGATTTTTGCCATTGCTTGAAGCATAGTAAGAATTTTATAAAAGTTAGGTCATTTCTTTTTCAAAATAATG
GTTTGGTTTTATTAATTCTTTGAGGGTATTTTACTCTGTATTTGGGTCATATTCATCCCCTACTCCAGGCTCCTCCCAAA
ACTACCCCCCCCCCN
Sequence Type genomic DNA
Unitrap ID UNI31861

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 90498446..90498859 414
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020546 (Stxbp4) NM_011505 syntaxin binding protein 4 Gene [Source:MGI (curated);Acc:Stxbp4-001]

 
Come back to gene ENSMUSG00000020546


For any suggestions or comments, please send an email to unitrap@crg.es