Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XT0781
Clone ID XT0781
Vector pGT0lxf
Project sanger

Sequence tag XT0781
Sequence
TTTTTAGAAGGTTTTTTTTTTTTTTTTTAAAAAGGAAAGCCGAGCCATATGACACTAGCCAAGGGAAAGGCACTCCTAGG
GGACATAAAATTAGTGATTACTTTGAGTTTGCTGGGGGAAGCGGGCCAGGAACCAGCCCTGGCAGAAGTGTTCCACCAGT
TGCACGATCCTCACCGCAACATTCCTTATCCAATCCCTTACCGCGTCGAGCAGAACAGCCTCTGTATGGTTTAGATGGCA
GTGCAGCAAAGGAGGCCTCAGAAGAGCAGTCTGCTCTGCCCACCCTCATGTCAGTGATGTTAGCAAAACCGCGACTTGAC
ACAGAGCAGTTAGCGCCACGGGGAGCTGGCCTCTGCTTCACTTTCGTCTCT
Sequence Type mRNA
Unitrap ID UNI3151

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104129319..105082667 170
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020694 (Tlk2) NP_036033 tousled-like kinase 2 (Arabidopsis) Gene [Source:MGI (curated);Acc:Tlk2-001]

 
Come back to gene ENSMUSG00000020694


For any suggestions or comments, please send an email to unitrap@crg.es