Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11017A6
Clone ID IST11017A6
Vector VICTR76
Project tigm

Sequence tag IST11017A6BBF1
Sequence
ATACAAATGTTGTAATTGTATGTGTACAGATTAGTGTCTCTGTACGTGTACGTACATGACTCTTGTACATGTGTCAGCTT
AACAGCTTATTGACTCATCTATGTTTGGTGTTCTAGATACTGGCAAAACACATGAGTGATGGTAGCATGAACCAGCTTCC
TTGTTTCCTTGGAGAGCCTGCCATGGTAAAGCCCATGTATCCCCAGTCTCGCGTCTTTCTGGTTATGAACATCATTTGTG
GTGTGCTCAGGAGCCGGCCTGCTTGGCCTGTCACAGACACCACCAGAAGCGACTGCAGCCACTTCTGTGCTTCTGAGTGC
CTGATGATTTGGCTGCCCTCTTTCTAAATACTTTTTTTTTATTGATTCTATGTATTTTTACTAAAGAAAGGATNNTATAT
TTGTTTGTAAAACTTANCAACAGTCANNTATCTTTAAGATTAAGTGTTGGGCCGGGTGGTGGTGGCCCATGCCTTTAATC
CCAGCACTTGGGAGGCANANGAANGAGGANTTCTGAGTTTGAGGCCNNCCTGGTCTACAAAGTGAN

Sequence Type genomic DNA
Unitrap ID UNI1957

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15125746..15126290 523
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079709 (AC182749.2-203) NP_001116842 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q8C5D3]

 
Come back to gene ENSMUSG00000079709


For any suggestions or comments, please send an email to unitrap@crg.es