Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14645E12
Clone ID IST14645E12
Vector VICTR74
Project tigm

Sequence tag IST14645E12BBF1
Sequence
TGGAAAGAAGACTTGGCCCATTTTAGAGACTTAAACGTCAGAGTTCTACTCCGGGCGGTGCCACCAGGGGACGGGATCGG
TGTCAGGAGTGGCTTGGCTAAGACTCCTTTCTTTCCACGCATCCTGCCTAAATAGACCGGCCTTCCAGANACTCCTGGCT
CCAAGCCCCAAAGCTGGAGTGGCCACCGGTGCTGACAGCACCCCTGCCGCCACCATANGCCGGCCTTGCTTTCACAGGTT
TTTCCCAGCGGGGGCTGGATTTCTGCCNNGCNAGGAATGTGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148255492..148255773 272
NO GENE  


Sequence tag IST14645E12HMF1
Sequence
TGGAAAGAAGACTTGGCCCATTTTAGAGACTTAAACGTCAGAGTTCTACTCCGGGCGGTGCCACCAGGGGACGGGATCGG
TGTCAGGAGTGGCTTGGCTAAGACTCCTTTCTTTCCACGCATCCTGCCTAAATAGACCGGCCTTCCAGAGACTCCTGGCT
CCAAGCCCCAAAGCTGGAGTGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148255589..148255773 185
NO GENE  


Sequence tag IST14645E12HMR1
Sequence
TCNNAACCCCCANAGCTTCNCCTTCCTTCAACGTTACCTTGGGATGGCAAGAAGGATGCTTCCTGCGGAGCTGTAACAGC
CAT
Sequence Type genomic DNA
Unitrap ID UNI20147

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148255774..148255852 75
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028977 (Casz1) NM_027195 castor homolog 1, zinc finger (Drosophila) Gene [Source:MGI (curated);Acc:Casz1-004]

 
Come back to gene ENSMUSG00000028977


For any suggestions or comments, please send an email to unitrap@crg.es