Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14869D9
Clone ID IST14869D9
Vector VICTR76
Project tigm

Sequence tag IST14869D9HMF1
Sequence
ATACTATGGATTATTTGCTCATTACTAGGTTTTAGACATATAATTGTCACCTAATCACTGTGTGTTCCTTTTGCAACAGC
TAAGCGATATGAGACTGAAGACACTCACACTTGTACAGCATGGCTCTACTAGGCTTGATTTAAACAGTAACATATCTGTT
AAGTCATTATTTCTCTGCCTTTGAACTAATGGAATGTCTTGCAAACAAAAATTACATATCTGCCATAGACATATATGATT
TTATGAAATTCNNTAAATATCCATGACTGAAAGAAGTGCTTATTTTACCCTATTGGTTNNCNTTNCTACTTGTANANCAC
GTTNAACTTTCTTTANNGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 176869378..176869712 317
 
EST/CDNA Est Name
  CX211778.1 - BI248726.1


Sequence tag IST14869D9BBF1
Sequence
ATACTATGGATTATTTGCTCATTACTAGGTTTTAGACATATAATTGTCACCTAATCACTGTGTGTTCCTTTTGCAACAGC
TAAGCGATATGAGACTGAAGACACTCACACTTGTACAGCATGGCTCTACTAGGCTTGATTTAAACAGTAACATATCTGTT
AAGTCATTATTTCTCTGCCTTTGAACTAATGGAATGTCTTGCAAACAAAAATTACATATCTGCCATAGACATATATGATT
TTATGAAATTCAGTAAATATCCATGACTGAAAGAAGTGCTTATTTTACCCTATTGGTTTTCTTTACTACTTGTAGAACAC
NTNAAACTTTCTTTATANGCNTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 176869370..176869712 335
 
EST/CDNA Est Name
  CB589696.1 - CX211778.1 - BI248726.1


Sequence tag IST14869D9HMR1
Sequence
GTATATCTGAGCTCAATGATATACTTATAATAACATTGCTAAATTTAGTGAGATGAACAGTTCATAAGATTCAAAAATGG
TTTTGTGGAAAAACCTTAATCTCTGTACCACATCTCTGTGACGAAAAAAAGTCAGCTGTGAATGTAATGTGGAATTTTCA
CTTGTTATTCTTCTTTTGATATGGATGTCNTANGTTATGATGGATATNAGCCTTGTGANCNNNGNNGCNTTGN
Sequence Type genomic DNA
Unitrap ID UNI1338

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 176869709..176869926 212
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078872 (OTTMUSG00000016569) predicted gene, OTTMUSG00000016569 Gene [Source:MGI Symbol;Acc:MGI:3650075]

 
Come back to gene ENSMUSG00000078872


For any suggestions or comments, please send an email to unitrap@crg.es