Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15052H3
Clone ID IST15052H3
Vector VICTR80
Project tigm

Sequence tag IST15052H3HMF1
Sequence
AAATGAGGTTCAAAGTGAGGCAGCTAAGGCTCAAAGACAGCACAATGGATGCTGTGCTAGAGGCTGACCCTCCCAGCACA
CAGTTATCTGGAATCACTACCTCCCTGTGTAATGAAGAACAGGGAGTATATATAGCCGTGACCATCAGCAAGTTCCTCTG
GGGCTGGCCTTAAAATGGAAAACCATCAATCAGGACAGAGGCAGAAGGAAAGGTCAGACAGAGGGGTCACTGCAAGGGCA
GGCACCGTTCCCTTGACATTACTCCTTTCCNCTCGCGTGAAAGGAGACGTTTTANANCCAGGCATCACCACCTAAAACAA
AGATGACAGANTATATGCCCNTCNCTTGGCGGAANANTGCTANGGGGTGTTNTCNTAAATNNGNNNGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6013592..6013971 358
 
EST/CDNA Est Name
  CD540754.1


Sequence tag IST15052H3HMR1
Sequence
NTTGAGGAGTGTATTGTCACCTGTGTTATGAAAGCAAAGATCTTGCCTTACTTAGCCTTTTCTTAAAAGAGTGTTTTGTC
TGCTTTGTATCTGGTGAATTTTCCCCTTAGCTATCAAAGTGGCGTCGCTGTTGTTAGAATTTGGGGTCAGAAGGGAAGGT
GTTGGTGATGCAGTTATGTAAACCCGAATCCACAGAGGAGTGGGGTGACTGCCATGTGCTGTCTACAACTGAATACTGGG
AAGTGGTTCTGTATTCTTAGTTCCCTGGGCCTTCAGGGATCCTGGGACACTGTGGGGGAAGTGTCTA
Sequence Type genomic DNA
Unitrap ID UNI486

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6013288..6013593 306
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038587 (Akap12) NM_031185 A kinase (PRKA) anchor protein (gravin) 12 Gene [Source:MGI Symbol;Acc:MGI:1932576]


Sequence tag IST15052H3BBF1
Sequence
AAATGAGGTTCAAAGTGAGGCAGCTAAGGCTCAAAGACAGCACAATGGATGCTGTGCTAGAGGCTGACCCTCCCAGCACA
CAGTTATCTGGAATCACTACCTCCCTGTGTAATGAAGAACAGGGAGTATATATAGCCGTGACCATCAGCAAGTTCCTCTG
GGGCTGGCCTTAAAATGGAAAACCATCAATCAGGACAGAGGCAGAAGGAAAGGTCAGACAGAGGGGTCACTGCAAGGGCA
GGCACCGTTCCCTTGACATTACTCCTTTCCACTCGCGTGAAAGGAGACGTTTTAGAGCCAGGCATCACCACCTAAAACAA
AGATGACAGAATATATGCCCATCACTTGGCGGAANATTGCTAGGGGGTGTTTTCTTAAATCTGCATGATCTANTCAATAA
ATATTTGCCAAGGTCATGCTCCACTTTTGTTGNGCTGANATCCANNGNGCGCTAATCANANATTATGGCCTTAGGATACN
TANTTGAGAGNGNNAANCCCTGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6013592..6014094 473
 
EST/CDNA Est Name
  CA881784.1 - BB665546.1 - CD539677.1 - CD540754.1

 
Come back to gene CA881784.1 - BB665546.1 - CD539677.1 - CD540754.1


For any suggestions or comments, please send an email to unitrap@crg.es