Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14582C6
Clone ID IST14582C6
Vector VICTR74
Project tigm

Sequence tag IST14582C6HMR1
Sequence
ANNNNNTATGGCTTTTAAATGAGTAGTTTCTCCCTCAAATCTAGCAATTACTTAATGTAGGCGCTCCTTCANANCCAGCA
ATTATTCCATAGTACTTTTCTAGAAAGTGTAATTTGGTTGTTACCTCAAATTAGGTTATTGCCGTCTAACATTCGGATGC
AGTAACCATCCTTATTTTACTAGAGTACATTTTGAGAGAGTATTGGTTGAATTTAAGGACAGAGTGTACATTAGAACGTA
TAGGTTCCCTGTGGTTGTCTTTTGTTGCCTTTTTTTCCCCCCAANACNTGGN
Sequence Type genomic DNA
Unitrap ID UNI2209

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 51029729..51030013 277
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023087 (Ccrn4l) NM_009834 CCR4 carbon catabolite repression 4-like (S. cerevisiae) Gene [Source:MGI (curated);Acc:Ccrn4l-001]


Sequence tag IST14582C6HMF1
Sequence
ATTTATATGTAGTTTGTGACCGTCGCAATCTGCTTTTAGGCAGAAAGGAGACACTTAAAAAACACAAGATGATGTACAGA
ACTGACTTCATGAAAGGTTGATTTACCAGGGATTTAAGACGAAGTGGAAGACTCCCCCCCTTCCAAAACATAAATAAATT
AATGAGCGTAACGAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 51029548..51029724 177
NO GENE  

 
Come back to gene ENSMUSG00000023087


For any suggestions or comments, please send an email to unitrap@crg.es