Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13861F4
Clone ID IST13861F4
Vector VICTR74
Project tigm

Sequence tag IST13861F4HMF2
Sequence
AGGGTTTCTCTGTATAGCCCTGGCTGTCCTGGAACTCACTTTGCANACCAGGCTGGCCA
Sequence Type genomic DNA
Unitrap ID UNI14335 UNI31508

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 76176664..76176721 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 23906805..23906862 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 13821501..13821558 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 28456389..28456446 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 39527428..39527485 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 45300980..45301037 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 93948311..93948368 56
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020859 (Spag9) NM_027569 sperm associated antigen 9 Gene [Source:MGI (curated);Acc:Spag9-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 36516906..36516963 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 12856300..12856357 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 12269319..12269376 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 93997788..93997845 56
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045095 (Magi1) NM_010367 membrane associated guanylate kinase, WW and PDZ domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1203522]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 71095207..71095264 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 53760460..53760517 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 32681394..32681451 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 87700431..87700488 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7564232..7564289 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 60031261..60031318 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 72279067..72279124 56
NO GENE  


Sequence tag IST13861F4BBF1
Sequence
AGGGTTTCTCTGTATAGCCCTGGCTGTCCTGGAACTCACTTTGCANACCAGGC
Sequence Type genomic DNA
Unitrap ID UNI14335 UNI30748

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 35910438..35910490 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 23906805..23906857 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 13821506..13821558 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 28456389..28456441 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 39527428..39527480 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 45300980..45301032 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 54348045..54348097 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 119810222..119810274 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 36516906..36516958 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 12856300..12856352 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 12269319..12269371 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 93997793..93997845 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045095 (Magi1) NM_010367 membrane associated guanylate kinase, WW and PDZ domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1203522]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52788647..52788699 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 53760460..53760512 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 32681394..32681446 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 33004316..33004368 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027674 (Pex2) NM_021483 peroxisomal biogenesis factor 5-like Gene [Source:MGI (curated);Acc:Pex2-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7564232..7564284 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 57266690..57266742 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 17225001..17225053 51
NO GENE  

 
Come back to gene ENSMUSG00000027674


For any suggestions or comments, please send an email to unitrap@crg.es