Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12470A12
Clone ID IST12470A12
Vector VICTR76
Project tigm

Sequence tag IST12470A12BBF1
Sequence
CCCCCACCCCTTTTTTCTTTTTGAAAAGAAGCAAATTCTCTGCCGTTTAAAGGCTCTGGAATGACCGATGTCATAATTAC
TTCCACTGGAGTTCCCTTTTGTTTGATAACCTTGACATTCTTTAAGAATTGCCAGTGGCCTATAGCCCACTACCCATACT
GTTTGGCATTTTAAATTACAATGAANACACTCCTATATCCTTAAGCAGTTATGTGTTCCAGTAACTTGAACAACTCACCT
TAATAAAACAACCCATCACTGATTATAATTTCATGTTTAAAAGGCTATATGCCTGTANTGTTTGGCTTGTATTTTTTTTT
NNCCN
Sequence Type genomic DNA
Unitrap ID UNI32838

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 103797035..103797354 316
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034187 (Nsf) NM_008740 N-ethylmaleimide sensitive fusion protein Gene [Source:MGI (curated);Acc:Nsf-001]

 
Come back to gene ENSMUSG00000034187


For any suggestions or comments, please send an email to unitrap@crg.es