Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13193G9
Clone ID IST13193G9
Vector VICTR74
Project tigm

Sequence tag IST13193G9BBF1
Sequence
ATGTCTATTTTAAAAACAAAGGGGGAATGATCCAGGTTCAATTCCCANCACCCACTAGGAGGTTTATCACCTCCTCAGGC
ACCAGGCACACATGTGGTGTATAGATGCACATGCATGTGAAACACTCATACACATAAAACAAACTCCAGTTCCAGGGGCT
CTCATGTTTTCTGGCCTCCCAGGGGCACCAGGTACACACATGGGACACAGGTATACATGCAGGTATAACACTCATACACA
TAAAATAAAATAAAATAAAAATTTTAAAGAAAAGAGGTGGTTCAATGGGTAAGAGCACTTGCTGTTCTTGCAAAGGATCT
Sequence Type genomic DNA
Unitrap ID UNI12508

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4709647..4709965 317
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009073 (Nf2) NM_010898 neurofibromatosis 2 Gene [Source:MGI (curated);Acc:Nf2-001]

 
Come back to gene ENSMUSG00000009073


For any suggestions or comments, please send an email to unitrap@crg.es