Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14746B9
Clone ID IST14746B9
Vector VICTR76
Project tigm

Sequence tag IST14746B9HMF1
Sequence
CCCNNATCTAATCTACTCATCACAAAGAACCANACTCCATGACAAAGAGCAAAAACCCTTCTGGCTCATAGCTGCAGAGG
ATAAAATGATCAATCTGGCTTAAAGAGGCCCAGATAATTTAAAATAGGTAGGTCCCTTGGGCATATCTTATTGAAAAGAA
CCAAGAGATCTTCCACTGTCCACACACACACACACACACACACACACATACAGAGAGAGAGACAGAGANATTCNNTCTNN
GNNNANATCCNTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14746B9BBF1
Sequence
CTCCCCAAATCTAATCTACTCATCACAAAGAACCAGACTCCATGACAAAGAGCAAAAACCCTTCTGGCTCATAGCTGCAG
AGGATAAAATGATCAATCTGGCTTAAAGAGGCCCAGATAATTTAAAATAGGTAGGTCCCTTGGGCATATCTTATTGAAAA
GAACCAAGAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 71696721..71696894 174
NO GENE  


Sequence tag IST14746B9HMR1
Sequence
GGGAGAAAACCTTGCGGTTCTCAAATTCAACACAGGCTGATGAGCACAGTGCATCTCCAAGGAACTTTAGGTCCTGGGCT
TTCTCTCAGGAAGTCTACAGCTGCGGCAGTCTTTCTCGTGTGACTCATTGGGTTGCCAGTACGTTCTATTAATAAGACTT
TCTCTCTAAAAACCAACTTTTAAATATAAGTCCTCTGTCCAAAAGAACCAATTAGTCCCTTCTGAATANACCAAATCAAT
ATTTCCAACATTTAACATGAGGGTTTTTTCCAAGTTTCCTGGCAAAGCCCAAGAGTCGATGGTACACTTGTGACCCTGCG
TACAATTCANCCATTGGATTTCACAGCCTAANAAAGTATCAGGGTTTCCAACCCTCATGAGTGTGTCTGCTTGCTTTCTG
CCANAGTGCTATTTCCACCCTGGAGTANAATGCANGCTCTCCGTCCTCCNNGAGANCGGAATGCTATGCCCAAGTAGCTC
ACCTTGCTGTCTANGANGACAGTTCCCCCAGCTCTTCTCTGTCNAGGGAACAGATTGCCTGTGATGTCTCCGGGGAACCN
CNNTTTATGACTTCTTGCCNTTCN
Sequence Type genomic DNA
Unitrap ID UNI10563

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 71696143..71696725 551
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026193 (Fn1) NM_010233 fibronectin 1 Gene [Source:MGI Symbol;Acc:MGI:95566]

 
Come back to gene ENSMUSG00000026193


For any suggestions or comments, please send an email to unitrap@crg.es