Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14587H4
Clone ID IST14587H4
Vector VICTR74
Project tigm

Sequence tag IST14587H4HMF3
Sequence
GGCTCAGTGGGTTAGAGCACCCGACTGCTCTTCCGAAGGTCCAGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAAC
CATCCGTAACAAGATCTGACTCCCTCTTCTGGAGTGTCTGAAGACAGCTACAGTGTACTTACATATAATAAATAAATCTT
TAAAAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 20917151..20917326 176
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 73218289..73218464 176
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115756930..115757105 176
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 59816033..59816208 176
NO GENE  


Sequence tag IST14587H4BBF2
Sequence
GGCTCAGTGGGTTAGAGCACCCGACTGCTCTTCCGAAGGTCCAGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAAC
CATCCGTAACAAGATCTGTCG
Sequence Type genomic DNA
Unitrap ID UNI12672

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 18030921..18031020 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026743 (Mllt10) NM_010804 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 Gene [Source:MGI (curated);Acc:Mllt10-001]


Sequence tag IST14587H4HMR1
Sequence
AAGCAGAANAGGTTGTTTNAAGGAGGTTGGCTNNNNAAACTGGATTCNTTTNAATGTTTTCTTGTGNANGGGANTTCCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000026743


For any suggestions or comments, please send an email to unitrap@crg.es