Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12815A7
Clone ID IST12815A7
Vector VICTR76
Project tigm

Sequence tag IST12815A7HMR1
Sequence
TCTGTATATACATGTATGTTCAAGTANGTACATATGTGTGANTGTANGATTATGTANCNNANATCANCNTNNNTGTCTTC
TTCNATTGCTTTTTCACCTATTTTAAAACAATTACTTTTGCTTCTGTATGTTTGGGTGCTTTGCCTGCTTGTATGTCNGT
GTACCANGTGTCTGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12815A7BBF1
Sequence
AAACTGCATACATGGTCAGGAGCACTGGCTGTTTTCCTTGAGGACCTGGGTTTCGTTCCTGGCACTGACATGGTGGTTCA
TAACCNCCTGTAACTCCATGTCCAGGAAGACCCAAGGCCCTCTTCCGGCCTCTGTGGGTACTGCATGCATGTGTGGCGGA
CATGTGTACTTGCAGACAAAGGCTCATACACATTTTTTAAAAAAGTTTATGTGGGTTGGTGAGATGACTCANCGGTTAAN
AGGGCTGANTGCTCTTCCAGANGTCTTGAGTTCAATCCCCAGCAACCACATGGTGGCTCACAACCNTCTGTAACAAGATC
TGT
Sequence Type genomic DNA
Unitrap ID UNI14987

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45594473..45594794 304
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023935 (Spats1) NP_081925 spermatogenesis associated, serine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1918270]

 
Come back to gene ENSMUSG00000023935


For any suggestions or comments, please send an email to unitrap@crg.es