Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14547E4
Clone ID IST14547E4
Vector VICTR74
Project tigm

Sequence tag IST14547E4HMR1
Sequence
AGTGTACTATCAACCGAGTGCTGGAGTTTATCAAGTGAACTCCAAATTGAGGGTTATTGTTTTCTGCTCAGGTGTCTGAC
AACCTTCCTATTGGAGTGCAGACTTAAAGTACTTTGATNATCTTTTTTTGTTTTTTGTTTTGTTTTGTTTTTTTGTTTTT
GTTTTTTCGAGACAGGGTTTCTCTGTGTANCCCTGGCTGTCCTGGAACTCACTTTGTANACTAGGCTGGTCNCNAACTGN
NNGCCN
Sequence Type genomic DNA
Unitrap ID UNI683

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 53958771..53959009 229
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039191 (Rbpj) NM_009035 recombination signal binding protein for immunoglobulin kappa J region Gene [Source:MGI Symbol;Acc:MGI:96522]


Sequence tag IST14547E4BBF1
Sequence
CACTCTTTCAGAGTTTATAGGTTTGGCTCTTTCTACTGTTCCTTGGTGAAAGCTACATGGGAAAAGTAAGAAGTGCAGTG
TGTCTTGATACCAATCATTAGCTTTGGTATTACAGACTCCTTTGAGTGAATGTGCATACGCCCTGGGCTCTGCAAGCATC
GGGTGCTTTTTATCCCTATTGAGAGGTGAAATGCGAATCCAAAATTCAACTGATTTATCCTGGGATACCCCAGGTCAGAT
GCAGATAAAAATCAAGGCTGGCGATGTCTAACGGCTCTGCGCANAGCTGGCTCCTTGGTATGGCATGAGGTCCTGGGCTC
AAGCTCCANGACTTNNNAGAAGAGACAAGGGGTANCAGGAAGAGGGAANGACANANNCNNATGCTNAAGATGGTTATCTT
CTNCNTGANCCCANNCCTGTNNGNACCNNNNNCACTGTTTGCCCAACCCTGCTTTTGCATTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000039191


For any suggestions or comments, please send an email to unitrap@crg.es