Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14885B10
Clone ID IST14885B10
Vector VICTR76
Project tigm

Sequence tag IST14885B10BBF1
Sequence
GGAGTAGGTGTGACCTTGTTGGATTAGGTGTGTCACTGTGGGTGTGGGCTTTAAGACCCTCATCCAAGCTGCCTGGAAGC
CAGTATTCTGCTAGCAGCCTTCAGATGAAGATGTCGAACTCTCAGCTCCTCCTGAACCATGCTTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 38734286..38734429 144
NO GENE  


Sequence tag IST14885B10HMR1
Sequence
TCCAACAGGGCCNCACCTTTTGATAGTACTACTCCC
Sequence Type genomic DNA
Unitrap ID UNI5314

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 38734253..38734288 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063972 (Nr6a1) NM_010264 nuclear receptor subfamily 6, group A, member 1 Gene [Source:MGI (curated);Acc:Nr6a1-001]

 
Come back to gene ENSMUSG00000063972


For any suggestions or comments, please send an email to unitrap@crg.es