Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14840E5
Clone ID IST14840E5
Vector VICTR76
Project tigm

Sequence tag IST14840E5HMF1
Sequence
GTTCAACTTCCTGCCCCACCAGAGGAAGTGGGGAGCAACACCAGGTGCAAGCGACAACCAGCAGAGCCATGGTGAGTTCT
CGGGGGCCCAGGAATCTAGTCATTCAGGGCCAGCTCTCTCCCTCGAGGGTCCCCAGTTCAAAGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI15868

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134361844..134361991 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000486 (Sept1) NM_017461 septin 1 Gene [Source:MGI (curated);Acc:Sept1-001]


Sequence tag IST14840E5HMR1
Sequence
TGTTCTTTTGTCTTTGAGGTGTGTGAATGTTTTTGCATGCGTGTAAAGCCATTTTGTGCATGCTCGGTGCTCACAGAGGT
TAGATTCTCTANCACTGGAGGTACAGGTACCTGTGAGCCCTCGTGTGTGTGTGGGTGTGTGTGTGTGTGTGTGTGTGTGT
GNNCN
Sequence Type genomic DNA
Unitrap ID UNI4014

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35526667..35526827 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041408 (Wapal) NM_001004436 wings apart-like homolog (Drosophila) Gene [Source:MGI (curated);Acc:Wapal-001]

 
Come back to gene ENSMUSG00000041408


For any suggestions or comments, please send an email to unitrap@crg.es